AP BIOLOGY

Detailed explanation-1: -Explanation: In DNA finger printing, the differences in the specific regions of the DNA sequence are called as Repetitive DNA. In this part, a small structure of the DNA is repeated many times. These repetitive structures can be separated from the bulk genomic DNA.

Detailed explanation-2: -Option 2) DNA fingerprinting involves identifying differences in some specific regions in DNA sequence called as repetitive DNA, because in these sequences, a small stretch of DNA is repeated many times.

Detailed explanation-3: -STRs are 2-5 bp DNA sequences that are repeated several times in succession. For example, “GATAGATAGATAGATAGATAGATAGATAGATA” is an example of repeated GATA sequences, which is one of the main STR markers used for DNA fingerprinting. STRs occur throughout the genome.

Detailed explanation-4: -Tandem Repeat Tandem repeats are generally present in non-coding DNA. In some cases, tandem repeats can serve as genetic markers to track inheritance in families. They can also be useful for DNA fingerprinting in forensic studies.

Detailed explanation-5: -Telomeres and aging. Telomeres are repetitive DNA sequences that are wrapped in specific protein complexes and located at the ends of linear chromosomes.